From DNA to protein, one codon at a time.
Type or paste a coding strand. We transcribe it, read the codons in your chosen frame, and build the amino acid chain, with every step shown and every base color-coded.
Type a coding strand. Watch it become protein.
Letters A, C, G, T only; spaces, line breaks, numbers, and FASTA headers are ignored. Up to 3,000 nt.
Example sequences
Reading frame
Follow the flow of information
Genetic code chart
The genetic code is the dictionary a ribosome uses to turn mRNA into protein. Each three-base codon names one amino acid or a stop signal. Find the codon’s first base in the left column, its second base in the next column, and its third base along the top: the cell where they meet is the amino acid. AUG both encodes methionine and marks where translation begins, and the three highlighted stop codons (UAA, UAG, UGA) end it.
| 1st base (5′) | 2nd base | 3rd base: U | 3rd base: C | 3rd base: A | 3rd base: G |
|---|---|---|---|---|---|
| U | U | UUU Phe (F) | UUC Phe (F) | UUA Leu (L) | UUG Leu (L) |
| C | UCU Ser (S) | UCC Ser (S) | UCA Ser (S) | UCG Ser (S) | |
| A | UAU Tyr (Y) | UAC Tyr (Y) | UAA Stop | UAG Stop | |
| G | UGU Cys (C) | UGC Cys (C) | UGA Stop | UGG Trp (W) | |
| C | U | CUU Leu (L) | CUC Leu (L) | CUA Leu (L) | CUG Leu (L) |
| C | CCU Pro (P) | CCC Pro (P) | CCA Pro (P) | CCG Pro (P) | |
| A | CAU His (H) | CAC His (H) | CAA Gln (Q) | CAG Gln (Q) | |
| G | CGU Arg (R) | CGC Arg (R) | CGA Arg (R) | CGG Arg (R) | |
| A | U | AUU Ile (I) | AUC Ile (I) | AUA Ile (I) | AUG Met (M) |
| C | ACU Thr (T) | ACC Thr (T) | ACA Thr (T) | ACG Thr (T) | |
| A | AAU Asn (N) | AAC Asn (N) | AAA Lys (K) | AAG Lys (K) | |
| G | AGU Ser (S) | AGC Ser (S) | AGA Arg (R) | AGG Arg (R) | |
| G | U | GUU Val (V) | GUC Val (V) | GUA Val (V) | GUG Val (V) |
| C | GCU Ala (A) | GCC Ala (A) | GCA Ala (A) | GCG Ala (A) | |
| A | GAU Asp (D) | GAC Asp (D) | GAA Glu (E) | GAG Glu (E) | |
| G | GGU Gly (G) | GGC Gly (G) | GGA Gly (G) | GGG Gly (G) |
Because 64 codons cover only 20 amino acids, the code is degenerate: 61 sense codons share the work, and most amino acids have more than one. Arginine, Leucine, Serine each have six codons, while methionine and tryptophan have just one. Notice that synonymous codons usually differ only in the third base, which is why a change there is often a silent mutation and why one tRNA can read several codons through third-position “wobble” pairing.
The chart is written in mRNA letters. To use it with a gene, take the coding strand of the DNA and swap every T for U, or read the template strand and write its complement. If a stop codon appears early in a reading frame, the frame is probably not the one the cell uses: try the other two frames, or tick “Begin at first AUG” in the translator above.
DNA translator questions
Wondering about the why? Start here.
What is the difference between mRNA and DNA?
DNA is a double-stranded helix built on deoxyribose that stores genes and stays in the nucleus, and it uses the bases A, T, G, and C. Messenger RNA is a single strand built on ribose with uracil (U) in place of thymine, copied from one gene and carried to a ribosome. The mRNA has the same sequence as the DNA coding strand with every T replaced by U, which is exactly what the translator shows when you type a coding strand.
Read: DNA structureHow do you translate a DNA sequence into a protein?
Transcribe the coding strand into mRNA by swapping T for U, split the mRNA into three-base codons from the start of the reading frame, and look each codon up in the genetic code: AUG codes for methionine and marks the start, and UAA, UAG, and UGA are stop signals. The demo strand ATGGCCATTGTAATGGGCCGCTGA… gives Met-Ala-Ile-Val-Met-Gly-Arg, seven amino acids, before the UGA at codon 8 ends the chain. Tick “Begin at first AUG” to translate the way a ribosome scans.
Read: transcription and translationWhat is a reading frame and why does it matter?
A reading frame is where you start counting codons: beginning at base 1, 2, or 3 splits the same mRNA into three completely different sets of triplets. Inserting or deleting a number of bases that is not a multiple of 3 shifts the frame, so every codon after the change is misread, usually producing a garbled protein and an early stop. Pick frame 1, 2, or 3 in the translator, or edit the sequence to see whether a mutation is silent, missense, nonsense, or a frameshift.
Meet the ribosome