biologylabEXPLORE THE LIVING WORLDWorksheets Paste a DNA coding strand, a template strand, or an mRNA sequence. We transcribe it into mRNA, line up the tRNA anticodons, read the codons in your chosen frame, and build the amino acid chain, with every step shown and every base color-coded.
A template strand printed under the coding strand runs 3′ → 5′ (TAC… becomes mRNA AUG…). Spaces, line breaks, numbers, and FASTA headers are ignored. Up to 3,000 nt.
Example sequences
Reading frame
A gene has two DNA strands. The template strand (antisense) is the one RNA polymerase reads, 3′ → 5′. The coding strand (sense) is its partner, and it has the same sequence as the mRNA except that DNA uses T where RNA uses U. Which rule you apply depends on which strand the question gives you.
| Coding strand (DNA) | 5′-ATG GCC TGA-3′ |
|---|---|
| Template strand (DNA) | 3′-TAC CGG ACT-5′ |
| mRNA | 5′-AUG GCC UGA-3′ |
| tRNA anticodons | 3′-UAC CGG ···-5′ |
| Protein | Met – Ala, released at the UGA stop |
Each tRNA carries an anticodon that base-pairs with one codon, antiparallel, so it is written 3′ → 5′ under the codon. Take the complement of each codon base: the codon 5′-AUG-3′ is read by the anticodon 3′-UAC-5′, which carries methionine. The translator shows this as the bottom row of the strand display. Because of third-position “wobble” pairing, one tRNA can often read more than one codon.
To go from mRNA to DNA, reverse the logic: swap U for T to get the coding strand, then take the complement to get the template strand. Choose “mRNA” in the translator and it does this for you. Going from a protein back to DNA has no single answer, because most amino acids have several codons: leucine alone has six.
Exam-style questions on transcription and translation, with the working. Paste any of these sequences into the converter above and pick the matching strand type to check.
Answer: UCA, which codes for serine (Ser).
Answer: 4 codons, translated as Met-Pro-Ser-Trp.
Answer: Met-Trp-His (N-terminus → C-terminus).
Answer: Met-Pro-Glu.
The genetic code is the dictionary a ribosome uses to turn mRNA into protein. Each three-base codon names one amino acid or a stop signal. Find the codon’s first base in the left column, its second base in the next column, and its third base along the top: the cell where they meet is the amino acid. AUG both encodes methionine and marks where translation begins, and the three highlighted stop codons (UAA, UAG, UGA) end it. For a searchable version and an amino-acid-to-codon table, open the codon chart.
| 1st base (5′) | 2nd base | 3rd base: U | 3rd base: C | 3rd base: A | 3rd base: G |
|---|---|---|---|---|---|
| U | U | UUU Phe (F) | UUC Phe (F) | UUA Leu (L) | UUG Leu (L) |
| C | UCU Ser (S) | UCC Ser (S) | UCA Ser (S) | UCG Ser (S) | |
| A | UAU Tyr (Y) | UAC Tyr (Y) | UAA Stop | UAG Stop | |
| G | UGU Cys (C) | UGC Cys (C) | UGA Stop | UGG Trp (W) | |
| C | U | CUU Leu (L) | CUC Leu (L) | CUA Leu (L) | CUG Leu (L) |
| C | CCU Pro (P) | CCC Pro (P) | CCA Pro (P) | CCG Pro (P) | |
| A | CAU His (H) | CAC His (H) | CAA Gln (Q) | CAG Gln (Q) | |
| G | CGU Arg (R) | CGC Arg (R) | CGA Arg (R) | CGG Arg (R) | |
| A | U | AUU Ile (I) | AUC Ile (I) | AUA Ile (I) | AUG Met (M) |
| C | ACU Thr (T) | ACC Thr (T) | ACA Thr (T) | ACG Thr (T) | |
| A | AAU Asn (N) | AAC Asn (N) | AAA Lys (K) | AAG Lys (K) | |
| G | AGU Ser (S) | AGC Ser (S) | AGA Arg (R) | AGG Arg (R) | |
| G | U | GUU Val (V) | GUC Val (V) | GUA Val (V) | GUG Val (V) |
| C | GCU Ala (A) | GCC Ala (A) | GCA Ala (A) | GCG Ala (A) | |
| A | GAU Asp (D) | GAC Asp (D) | GAA Glu (E) | GAG Glu (E) | |
| G | GGU Gly (G) | GGC Gly (G) | GGA Gly (G) | GGG Gly (G) |
Because 64 codons cover only 20 amino acids, the code is degenerate: 61 sense codons share the work, and most amino acids have more than one. Arginine, Leucine, Serine each have six codons, while methionine and tryptophan have just one. Notice that synonymous codons usually differ only in the third base, which is why a change there is often a silent mutation and why one tRNA can read several codons through third-position “wobble” pairing.
The chart is written in mRNA letters. To use it with a gene, take the coding strand of the DNA and swap every T for U, or read the template strand and write its complement. If a stop codon appears early in a reading frame, the frame is probably not the one the cell uses: try the other two frames, or tick “Begin at first AUG” in the translator above.
Wondering about the why? Start here.
DNA is a double-stranded helix built on deoxyribose that stores genes and stays in the nucleus, and it uses the bases A, T, G, and C. Messenger RNA is a single strand built on ribose with uracil (U) in place of thymine, copied from one gene and carried to a ribosome. The mRNA has the same sequence as the DNA coding strand with every T replaced by U, which is exactly what the translator shows when you type a coding strand.
Read: DNA structureTranscribe the coding strand into mRNA by swapping T for U, split the mRNA into three-base codons from the start of the reading frame, and look each codon up in the genetic code: AUG codes for methionine and marks the start, and UAA, UAG, and UGA are stop signals. The demo strand ATGGCCATTGTAATGGGCCGCTGA… gives Met-Ala-Ile-Val-Met-Gly-Arg, seven amino acids, before the UGA at codon 8 ends the chain. Tick “Begin at first AUG” to translate the way a ribosome scans.
Read: transcription and translationA reading frame is where you start counting codons: beginning at base 1, 2, or 3 splits the same mRNA into three completely different sets of triplets. Inserting or deleting a number of bases that is not a multiple of 3 shifts the frame, so every codon after the change is misread, usually producing a garbled protein and an early stop. Pick frame 1, 2, or 3 in the translator, or edit the sequence to see whether a mutation is silent, missense, nonsense, or a frameshift.
Meet the ribosomeIt depends on which strand you have. From the template strand, write the complement of every base with U in place of T (A → U, T → A, G → C, C → G), so 3′-TAC-5′ becomes 5′-AUG-3′. From the coding strand, keep the sequence and swap each T for U, so 5′-ATG-3′ becomes 5′-AUG-3′. Choose the strand type in the converter and it applies the right rule and shows the working.
See the steps with an exampleThe template (antisense) strand is the one RNA polymerase reads, 3′ → 5′, to build mRNA from complementary bases. The coding (sense) strand is its partner: it is not read, but it has the same sequence as the mRNA except for T in place of U. So the template 3′-TAC GGT-5′ pairs with the coding strand 5′-ATG CCA-3′, and both give the mRNA 5′-AUG CCA-3′.
Read: transcription and translationWrite the complementary base for each base of the codon, keeping U for RNA: A pairs with U and G with C. The anticodon runs antiparallel, so it is written 3′ → 5′: the start codon 5′-AUG-3′ is read by the anticodon 3′-UAC-5′, and 5′-GCC-3′ by 3′-CGG-5′. Stop codons (UAA, UAG, UGA) have no tRNA; release factors end translation instead.
Look up codons in the codon chart